RegulonDB RegulonDB 11.0: Gene Sequence
yneJ gene sequence


Size: 882        A: 193  T: 217  G: 245  C: 227

Fasta

 

>yneJ E. coli K12. Version NC_000913.3 GI:556503834
atggatctgacccaactggagatgttcaacgcggttgccgaagctggcagcataacccag
gctgcagcaaaagtgcatcgcgtgccgtcgaatctcactacccgtctgcgccagctggaa
acagaactgggggttgatctgtttattcgcgagaatcagcgtttacgtctctctcctgcc
gggcataactttttacgctatagccaacaaattctcgcgttagtggatgaagcgcggagc
gttgtcgctggcgatgagccgcaaggtttattttctcttggttcgctggaaagcaccgct
gcagtgcgcattccagccacgctggcggaattcaaccgtcgttatcccaaaattcagttt
tcactttccaccggcccttccggcactatgctggatggtgtactggagggaaaactgaat
gcggcgtttattgatggacccattaaccatactgccatcgacgggataccggtataccgc
gaggaactgatgatcgtcacgccacaaggatatgcgccagtaacccgtgccagtcaggtt
aatggcagtaacatttatgccttccgcgccaattgttcgtatcgtcgccacttcgagagc
tggtttcatgctgacggtgccgctccgggaactatccatgagatggagtcttatcacgga
atgttggcctgtgtgatcgcaggagcaggcattgcgcttattccgcgctctatgctggaa
agtatgccggggcatcaccaggttgaagcgtggccgttagctgagcaatggcgttggtta
acaacctggctggtctggcgtcgtggtgcgaaaacacgtccgctcgaggcatttattcaa
ctgctggatgtgcctgactcggcaagacagggatatcaatga
              
                            

Download fasta file
RegulonDB