RegulonDB RegulonDB 10.9: Gene Sequence
yneK gene sequence


Size: 1116        A: 345  T: 327  G: 192  C: 252

Fasta

 

>yneK E. coli K12. Version NC_000913.3 GI:556503834
atggttacgccagtaagcatcagcaattacatatctcttcctgatgattttcccgtacgt
aatattgcaccgcaggtaaaagaagttttaaaggattttattgatgcacttagtacaata
atatgtaatgaagagtggcgcacgtctttaaacatcaactcagccacaaaaaagatattt
aataaccttgacaacttatcatatattcagaggacttcttttcggggtaacgacacgcta
tacaatgaaaaggttcagtttaaactcacttatcccgccaggaatggaagacacaaagaa
aatattgaatttcaggtagtaataaatttaagccctatttatttagataattttcgccat
gatggagaaattaatattttttgcgctcccaacccaaagcctgtcactatggggcgcgta
tttcagaccggcgtcgagcgtgtactctttctgtttctgaatgattttattgaacaattt
ccaatgatcaaccctggtgttcccatcaaaagagcgcatacaccacatattgaacccctg
ccttcggatcaccataccgctgcagattacttacgccagtttgatttgcttgtcctgaat
tttatctctcgcggtaattttgtcatactcccccgattatggaataactctgaggttcac
agatggttcgtcaataaagatcctaacttgatcaccgccattctcgacataacggacagc
gaattaaaagaggatttgttgcaaagcctgatggattcattaggttctaacaaacatgta
ctacccgaagtctgcatctgctttttatcccttttagcagaacaagaatctcctcatttt
cagaacttgtttttatttttcgccaatatgttattgcactatcaccaatttatgaatccc
aatgaaagtgatttgaatgacgtgttgatgccagcatcattaagtgatgataaaattatc
aaacatatggcgcgcaggaccctcaaactgtttgtaaaaaatgaaacaccgccaaaagtt
actcacgaagacctggtgaaaaacaggcctcgctcccctgtcagaccacctatacccgca
accgccaaaacgccagacctccctgaacgtcattaa
              
                            

Download fasta file
RegulonDB