RegulonDB RegulonDB 10.9: Gene Sequence
ydfZ gene sequence


Size: 204        A: 55  T: 43  G: 54  C: 52

Fasta

 

>ydfZ E. coli K12. Version NC_000913.3 GI:556503834
atgacgacctacgatcgtaaccgtaacgcaatcaccactggcagccgtgttatggttagc
ggcaccggtcacactggcaagatcctgtcgattgatactgaaggtctgaccgctgagcaa
atccgccgcggaaaaaccgtagttgttgaaggttgtgaagagaaactggcaccactggac
ctgattcgtctcggcatgaactaa
              
                            

Download fasta file
RegulonDB