RegulonDB RegulonDB 10.9: Gene Sequence
ydfI gene sequence


Size: 1461        A: 373  T: 365  G: 404  C: 319

Fasta

 

>ydfI E. coli K12. Version NC_000913.3 GI:556503834
atgggaaataatttgttatcagcaaaagcgacactccctgtttatgatcttaataacctg
gctccaagaattgttcatttaggctttggtgcatttcaccgtgcgcatcagggtgtgtat
gccgatattcttgctacggaacatttcagtgactggggatattatgaggtcaacttaatc
ggcggcgaacagcaaattgccgatttacaacagcaagataatctttataccgttgcggaa
atgtcggccgatgtgtggacggctcgcgtcgttggcgtcgttaaaaaagccttgcacgta
cagatagatggcttagaaaccgtgttggcagcgatgtgtgaaccgcaaatcgcgattgtc
tctctgacaatcaccgaaaaagggtatttccactctccggcgaccggacagttaatgctc
gatcacccgatggtagctgccgacgtgcaaaatccccaccagccgaaaacagcaacaggg
gtgattgttgaggcgctggctcgccgtaaagcggcaggacttcccgcatttaccgtcatg
tcatgtgacaacatgccagaaaacggtcatgttatgcgtgacgttgtcacttcctacgca
caagccgttgatgtaaaactggcacaatggatcgaagataacgtgactttcccatcaaca
atggtggaccgtattgtgcccgcagtgacagaggatacgctggcgaaaatcgaacaactt
accggtgtgcgcgatcctgcgggcgttgcctgtgaacctttccgccagtgggtaatagaa
gataactttgttgccggacgtccggaatgggaaaaagcgggagccgaactggttagcgat
gtgctgccttatgaagagatgaagttgcgcatgctcaacggcagtcattcattcctggcg
tatctggggtatcttgcaggatatcagcacattaatgactgtatggaagatgaacattat
cgttatgcggcgtatggcttgatgttgcaggaacaagcgccgacgttgaaagtgcagggc
gttgatttgcaagattacgctaaccgattaattgcacgctatagcaacccggcgttacgt
catcgaacctggcagattgcgatggatggtagccagaaattgccacagcggatgttggat
tctgttcgctggcatctggcgcatgacagcaagttcgatctgctggcgctgggcgtcgcg
ggttggatgcgttatgtcggtggtgttgatgaacagggaaatccgatagaaatcagtgac
ccactgttacctgttattcagaaggctgtacaaagtagtgccgaagggaaagcgcgcgtc
cagtcattgctggcgattaaggcgatctttggtgatgatttgccagacaatagtttgttt
actgcaagagtgacggaaacgtacttgtctttattagcgcatggcgcgaaagcgaccgtg
gcaaaatattccgtgaagtaa
              
                            

Download fasta file
RegulonDB