RegulonDB RegulonDB 10.9: Gene Sequence
ydfJ gene sequence


Size: 1284        A: 300  T: 381  G: 335  C: 268

Fasta

 

>ydfJ E. coli K12. Version NC_000913.3 GI:556503834
atggatttccagttatattcgctcggcgcagcgttagtgtttcatgaaatattttttcct
gaatcatcaacggcaatggcgttaattctggcaatgggaacctacggtgcaggttatgtg
gcgcgtattgtcggagcatttattttcggcaaaatgggcgacagaatagggcgtaaaaaa
gtgctctttattaccatcaccatgatggggatctgtaccaccttaattggtgtgttaccg
acctatgcacagattggtgtttttgcacccatcttgctggtgacgttgcgtattattcag
gggttgggtgcaggtgcggaaatttccggtgccggtacgatgctggcggaatatgcgcca
aaaggtaagcgcggaattatctcctcatttgtggctatgggaactaactgcggaaccttg
agcgcaacggcaatctgggcctttatgttcttcattctcagtaaagaggaactgctggcg
tggggatggcgtataccgttcctggcgagtgttgtcgtgatggtctttgctatctggttg
cgtatgaatctgaaagaaagcccggtctttgagaaggttaacgacagtaaccaaccgaca
gcaaaacctgcacctgctggtagcatgttccagagcaaatccttctggctggcaacaggg
ctgcgttttggtcaggcgggtaactccgggttaattcagactttccttgcaggctattta
gtgcagacgttattgtttaacaaagcaattccaacagatgcattgatgatcagttcgatt
ctcggctttatgaccattccgttccttggttggttatccgataaaattggtcgccggatc
ccgtatattattatgaatacctccgcgattgtgctggcatggccaatgctttctatcatt
gtagataaaagctatgccccgagcaccattatggttgcactgattgtgattcataactgt
gcggtgctgggattatttgctctggaaaacattaccatggcagaaatgttcggctgtaaa
aaccgctttacccggatggctatttctaaagaaattggtggtcttatcgcttccggtttt
ggtcctatcctggcgggtattttctgcaccatgacggaatcctggtatccgatcgccatt
atgatcatggcatattcagtgattggtttaatctctgcgctgaaaatgccagaggtgaaa
gaccgtgatttaagtgcgctggaagacgctgcggaagatcaaccgcgtgttgtaagagct
gcgcaaccttccagaagtctgtaa
              
                            

Download fasta file
RegulonDB