RegulonDB RegulonDB 10.9: Gene Sequence
tfaQ gene sequence


Size: 576        A: 162  T: 136  G: 160  C: 118

Fasta

 

>tfaQ E. coli K12. Version NC_000913.3 GI:556503834
atggcattcagaatgagtgaacaaccacggaccataaaaatttataatctgctggccgga
actaatgaatttattggtgaaggtgatgcatatattccgcctcatacaggtctgccagca
aacagtaccgatattgcaccgccagatattccggctggcttcgtggctgttttcaacagt
gatgagtcatcgtggcatctcgttgaagatcatcggggtaaaacggtttatgacgtggct
tccggcgacgcgttatttatttctgaactcggtccgttaccggaaaatgttacctggtta
tcgccggaaggggagtttcagaagtggaacggcacagcctgggtgaaggatacggaagca
gaaaaactgttccggatccgggaggcggaagaaacaaaaaacaacctgatgcaggtagcc
agtgagcatattgcgccgcttcaggatgctgcagatctggaaattgcaacggaggaagaa
atctcgttgctggaagcatggaaaaagtatcgggtattgctgaaccgtgttgatacgtca
actgcacaggatattgaatggccagcactgccgtag
              
                            

Download fasta file
RegulonDB