RegulonDB RegulonDB 10.9: Gene Sequence
stfQ gene sequence


Size: 963        A: 246  T: 210  G: 254  C: 253

Fasta

 

>stfQ E. coli K12. Version NC_000913.3 GI:556503834
gtgaatataaccgcgctgacagacaatacgcagggggcagcaggtcttgagttatacgag
gtgtataacaacggatatccaacagcgtatggaaatatcattcacctgaaagggatgaca
gccgttggcgaaggtgagttactcatcggctggagtggtacaagcggtgctcatgctccg
gcatttattcgttcacgacgggatacgaccgacgcaaactggtcgccgtgggcgcagctt
tacacctcggctcatcctcctgcagagttttatccagtcggtgcaccaatcccgtggcca
tcagataccgttccgtctggttatgccctgatgcaggggcagacttttgacaaatctgca
tacccgaaacttgcagttgcttatccgtcaggcgtgatccctgatatgcgtggctggacg
attaagggcaagcccgccagtggtcgggccgtattatctcaggaacaggacggcattaaa
tcgcacacccacagcgccagcgcatccagtacggatttggggacggaaaccacatcgtcg
tttgattacggaaccaaatccacgaataacaccggggcgcatacccatagtattagcggg
accgcaaatagtgccggtgcgcaccaacacaagagttccggtgcatttggtggcacgaac
acgagcattttccctaatggttataccgcgatttcaaatctaagcgcggggattatgagc
acaacaagcggtagtggccagactcgtaatgcagggaagacatcatcagatggtgctcat
acccactcgctgtccggcactgctgcaagcgcaggcgcgcatgcacatactgtcggtatt
ggtgctcatacgcactccgttgcgattggttcacatggacacaccatcaccgttaacgct
gctggtaacgcggaaaacaccgtcaaaaacatcgcatttaactatattgtgaggcttgca
taa
              
                            

Download fasta file
RegulonDB