RegulonDB RegulonDB 10.9: Gene Sequence
ydfO gene sequence


Size: 411        A: 158  T: 123  G: 62  C: 68

Fasta

 

>ydfO E. coli K12. Version NC_000913.3 GI:556503834
atggatcaggtagtcatttttaaacaaatatttgataaagttcgaaacgatttaaactat
caatggttttattctgagctaaaacgtcacaatgtctcacattacatttactatttagcc
acagagaatgttcatattgtattaaaaaatgataatacagtgttattaaagggcctaaaa
aacattgtgtctgtcaaattttcaaaggataggcatcttatagaaacgacctctaataag
ctgaaatccagagagatcacatttcaggaatacagaagaaaccttgctaaagcaggagtt
tttcggtgggttacaaatatccacgaacaaaaaagatattactatacctttgataattca
ttactatttactgaaagcatccagaaaactacacagatcttaccacgctaa
              
                            

Download fasta file
RegulonDB