RegulonDB RegulonDB 10.8: Gene Sequence
gnsB gene sequence


Size: 174        A: 79  T: 43  G: 31  C: 21

Fasta

 

>gnsB E. coli K12. Version NC_000913.3 GI:556503834
atgaatattgaaaacttaaaaacaaaagcagaagcagatatttctgaatatataacaaaa
aaaattattgaacttaagaaaaagaccgggaaagaagttaccagtattcagtttaccgca
cgggaaaaaatgacgggtcttgaaagctatgatgtcaagattaatttaatctga
              
                            

Download fasta file
RegulonDB