RegulonDB RegulonDB 10.9: Gene Sequence
ynfN gene sequence


Size: 156        A: 49  T: 39  G: 36  C: 32

Fasta

 

>ynfN E. coli K12. Version NC_000913.3 GI:556503834
atgcgtgaatatccaaatggcgaaaaaacacaccttactgtaatggccgcagggtttcca
tctctgaccggagatcataaagtcatttatgtagccgcggatcgacatgttacttcagaa
gaaattctggaagcagcaataaggctcttgagttga
              
                            

Download fasta file
RegulonDB