RegulonDB RegulonDB 10.9: Gene Sequence
cspI gene sequence


Size: 213        A: 65  T: 62  G: 50  C: 36

Fasta

 

>cspI E. coli K12. Version NC_000913.3 GI:556503834
atgtctaacaaaatgactggtttagtgaaatggtttaaccctgaaaaaggttttggtttc
atcacgccgaaagatggcagcaaagatgtgtttgtccatttctcagcaattcagagcaac
gatttcaaaacattaactgagaatcaggaagttgaatttggtattgagaacggacctaaa
ggtcctgccgctgttcatgtagtggcgctttga
              
                            

Download fasta file
RegulonDB