RegulonDB RegulonDB 10.9: Gene Sequence
ydfR gene sequence


Size: 312        A: 96  T: 80  G: 78  C: 58

Fasta

 

>ydfR E. coli K12. Version NC_000913.3 GI:556503834
atgactcaagactatgaactggttgtgaaaggagtccgtaattttgagaataaagttacg
gtaactgtagccttacaggacaaagaacgctttgacggtgaaatttttgacctggatgtc
gccatggaccgtgttgaaggagctgcgctggagttttatgaggcagcagccagaaggagc
gtccggcaagtcttcctggaagtagcagaaaaattgtcagaaaaagttgagtcttatctg
cagcatcagtactcctttaagattgaaaatcctgccaataagcacgagcgtcctcatcat
aaatatctatga
              
                            

Download fasta file
RegulonDB