RegulonDB RegulonDB 10.9: Gene Sequence
essQ gene sequence


Size: 216        A: 58  T: 58  G: 62  C: 38

Fasta

 

>essQ E. coli K12. Version NC_000913.3 GI:556503834
atgaaatcaatggataagttaacaacaggtgttgcctatggcacatcggcgggtaatgct
ggtttctgggcattgcagttactcgataaagtaactccgtcacagtgggctgcaatcggt
gtgctgggtagcctggtttttggcctgctgacgtatctgacaaatctttatttcaagatt
aaagaagacaggcgtaaggctgcgagaggagagtaa
              
                            

Download fasta file
RegulonDB