RegulonDB RegulonDB 10.9: Gene Sequence
ydfT gene sequence


Size: 753        A: 212  T: 180  G: 215  C: 146

Fasta

 

>ydfT E. coli K12. Version NC_000913.3 GI:556503834
atgaaccttgaagccttaccaaaatattactccccaaaatctccaaaattgagcgatgac
gctccagcgacaggcaccggttgtttaacaattacggatgtaatggcagcgcaggggatg
gtgcagtcgaaagcaccacttgggttggccttatttctggcaaaagttggtgttcaggac
cctcagtttgcgattgaaggcctgctaaattacgcgatggcactggataacccgacattg
aacaaattgagtgaagaaatccggttacagattattccttacctcgtgagttttgccttt
gctgattactccaggtctgcggcaagtaaggctcgctgtgagcattgttcaggtacggga
ttttataatgtattgcgcgaagtggtgaaacactacagacgcggggaatctgtaatcaag
gaagaatgggtgaaggaactatgtcagcattgccatggtaagggcgaagccagcacagcg
tgcagagggtgtaagggtaaagggattgttctggatgaaaaaagaacccggtttcatggc
gtaccggtatataagatttgtgggcgttgtaatggaaaccggtttagtcgtttaccgacc
acgctggcacgacgtcatgtccagaagctggtaccagacctgaccgattatcagtggtat
aaggggtatgcggacgtcattggtaaactggtaacaaagtgctggcaggaagaagcatac
gcggaagcgcaattgaggaaggtgacgagataa
              
                            

Download fasta file
RegulonDB