RegulonDB RegulonDB 10.9: Gene Sequence
ydfU gene sequence


Size: 1050        A: 256  T: 246  G: 287  C: 261

Fasta

 

>ydfU E. coli K12. Version NC_000913.3 GI:556503834
gtgcgggtattacttagacctgttctggtgcctgagcttgggctggtggtccttaagccg
ggccgtgaatccatacagatatttcataatcctcgagtgctggtggaaccggaaccaaaa
agcatgcgtaatctgccatccggagtcgttcctgccgttcgccagccgctggcggaagac
aaaacattgctgccgttttttagtaacgaacgggtgattcgtgctgctggcggcgttggc
gcattgtccgactggctattacgtcatgttacatcctgccagtggcctaatggcgattac
catcacactgaaacagtcattcaccgttatggtaccggcgcaatggtgttgtgctggcac
tgcgacaaccaactgcgtgaccagacatcggaatcactggagctgcttgctcaacaaaat
ctgacagcatgggtgattgacgtcatccgtcacgcaataagcggtacgcaggagcgggaa
ttatctttggctgaattatcctggtgggcggtctgcaatcaggtggtggatgcactacct
gaggctgtatcgcgtcgttcgctgggattaccagcggaaaaaatctgctcggtgtaccgc
gaaagcgacatcgtaccgggagagctgaccgccaccagcatattgaaacaacgcacaaaa
aatcttgcaccgttgccttacgcccaccagcaacaaaaatcaccacaggaaaagacggtg
gtaagcatcaccgttgatccagagtctccggaatctttcatgaagctgcctaaacgtcgc
cgctgggttaaggagaaatacacacgttgggttaagacacagccgtgtgcttgctgcggt
atgccagccgacgatccgcatcatctgattggtcacgggcagggcggaatgggaacaaaa
gcacatgatctctttgtgttgcctttgtgcagaaagcatcacaacgagctgcatacggat
acagtggcatttgaagataagtatggctcccaactggagctgatatttcgttttatcgat
cgcgcgctggcaattggcgtactggcgtaa
              
                            

Download fasta file
RegulonDB