RegulonDB RegulonDB 10.9: Gene Sequence
ydfV gene sequence


Size: 306        A: 76  T: 89  G: 71  C: 70

Fasta

 

>ydfV E. coli K12. Version NC_000913.3 GI:556503834
atgtcattacaagtatcgcactacaacatgcttagggcaagtcacgaaggaagtcagaaa
gtagtcgtaagaacggtgatcactgtccgctttgtgccaggagcagccattgctaagtcc
atcctgtattgtgcaggtcagctcgtttttaaagagtccggccatcatcttactggtaca
gacaccatatactttgtgacggtcaggctacatatgcacaactcaacttattcatctatt
ttttgctttagcatgtcagtgttgctttctcgtcggcgggtgagcggtgacctgacctgt
cgataa
              
                            

Download fasta file
RegulonDB