RegulonDB RegulonDB 10.9: Gene Sequence
ydfW gene sequence


Size: 150        A: 52  T: 33  G: 28  C: 37

Fasta

 

>ydfW E. coli K12. Version NC_000913.3 GI:556503834
gtggataatgcccgtattgatttacgctcaaaatactatgttaaacctaaagctgaccat
ccctggcttacgcgccgaacgcaaagtcatcagcaagttaagcccccgaagttacctaaa
aagaagcctgatcccgataaaaaagattga
              
                            

Download fasta file
RegulonDB