RegulonDB RegulonDB 10.9: Gene Sequence
ydfX gene sequence


Size: 291        A: 81  T: 63  G: 86  C: 61

Fasta

 

>ydfX E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatcactcctgaacaggctcgtgaggctctggatgcctggatatgtcgaccagga
atgacacaggagcaggcgacgatattaatcactgaagcattctgggctttgaaagagcgc
ccgaacatcgatgttcagcgtgtcacatatgaaggtggcgcgattgatcagcgagcgctt
ggcgttaatcgagtgaagatatttgaacgctggaaggctatcgacaccagggataagcgt
gaaaagttcacggcgctagtgcctgcaattatggaggctaccactggatga
              
                            

Download fasta file
RegulonDB