RegulonDB RegulonDB 10.10: Gene Sequence
insD7 gene sequence


Size: 657        A: 167  T: 133  G: 203  C: 154

Fasta

 

>insD-7 E. coli K12. Version NC_000913.3 GI:556503834
atgcctgcgatcaatgccaaacgtgtttaccggatcatgcgccagaatgcgctgttgctt
gagcgaaaacctgctgtaccgccatcgaaacgggcacatacaggcagagtggccgtgaaa
gaaagcaatcagcgatggtgctctgacgggttcgagttctgctgtgataacggagagaga
ctgcgtgtcacgttcgcgctggactgctgtgatcgtgaggcactgcactgggcggtcact
accggcggcttcaacagtgaaacagtacaggacgtcatgctgggagcggtggaacgccgc
ttcggcaacgatcttccgtcgtctccagtggagtggctgacggataatggttcatgctac
cgggctaatgaaacacgccagttcgcccggatgttgggacttgaaccgaagaacacggcg
gtgcggagtccggagagtaacggaatagcagagagcttcgtgaaaacgataaagcgtgac
tacatcagtatcatgcccaaaccagacgggttaacggcagcaaagaaccttgcagaggcg
ttcgagcattataacgaatggcatccgcatagtgcgctgggttatcgctcgccacgggaa
tatctgcggcagcgggcttgtaatgggttaagtgataacagatgtctggaaatatag
              
                            

Download fasta file
RegulonDB