RegulonDB RegulonDB 10.9: Gene Sequence
intQ gene sequence


Size: 1197        A: 399  T: 293  G: 261  C: 244

Fasta

 

>intQ E. coli K12. Version NC_000913.3 GI:556503834
gtgataacagatgtctggaaatataggggcaaatccacaggtgaactacgctcctctgtt
tgttacgcaataaaaactggtgttttcgactatgcaaaacagtttccctcctcacgcaat
ctggaaaaatttggtgaggcccgacaagatttaaccataaaagaactggctgaaaaattt
ctggcactgaaagaaactgaagtcgccaaaacatcactcaacacataccgtgccgtcatc
aaaaatatcctgagcataatcggtgaaaaaaatcttgcctcatcgattaataaagaaaaa
ttactggaggttcgtaaagagttactgactggataccagatccccaaaagtaactatatt
gttacacaaccagggagatcggctgtaactgtaaataattacatgacaaatcttaacgcc
gtgttccagtttggtgttgataacggttacctggcagataatccgtttaaggggatctcg
ccattaaaggaatcaagaaccattccggatcctctttcgcgggaagaatttatccgtctt
atcgatgcgtgcagaaatcagcaagcaaaaaatttatggtgtgtttctgtttatactgga
gttcgccctggtgagctgtgtgcacttggatgggaggacatagatctgaaaaatggaaca
atgatgatcaggagaaatttagcaaaagaccgtttcacggtaccaaaaacacaggcggga
accaatcgggtcattcatcttattaagccagcaatcgacgctctccggagtcagatgaca
ttaacgagactgagcaaagagcatatcattgatgttcacttcagagagtatggcagaaca
gaaaaacaaaaatgcacctttgtttttcaacctgaagtgtcagcgagagtaaaaaattat
ggtgaccattttaccgttgactcaataaggcagatgtgggacgcagcgataaaacgtgcc
ggactccgccatcgaaaatcatatcagtcgagacatacttatgcctgctggtcgctgaca
gctggtgctaacccggcatttatagcaaaccagatgggccatgcagatgcgcaaatggta
tttcaggtatacggaaaatggatgtctgaaaacaataatgcacaggtagctttgttaaat
acacagttaagcgagtttgccccaaccatgccccataacgaagcaatgaaaaattaa
              
                            

Download fasta file
RegulonDB