RegulonDB RegulonDB 10.9: Gene Sequence
rspB gene sequence


Size: 1020        A: 285  T: 277  G: 252  C: 206

Fasta

 

>rspB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaagcatattaattgaaaaaccgaatcaactggcgattgtcgaacgtgaaataccc
accccgtcagcgggtgaagtacgagtaaaagtgaaacttgccggaatttgtggttcagat
agccatatttatcgtgggcataatccttttgcgaaatatccgcgcgtcattggtcatgaa
ttctttggcgtcattgatgcagtgggtgaaggcgtggaaagcgccagagtcggtgaacgt
gttgctgtcgatccggtggtcagctgtgggcattgctatccgtgctctataggtaaaccg
aacgtttgtacgacactggctgtattaggtgtgcacgctgacggtggtttcagtgaatat
gccgtggttccggcaaaaaatgcgtggaaaattcctgaagcagtggccgatcaatatgcg
gtaatgatcgaaccttttaccattgcggctaacgtaaccggacatggtcaaccgactgaa
aatgataccgttctggtttatggtgccggtccaatcggcctgacgatcgttcaggtatta
aaaggcgtctataacgttaaaaatgtgattgttgccgatcgcattgatgaacgactggaa
aaagcgaaagagagcggggctgactgggcgattaataacagccagacaccgcttggcgag
attttcactgaaaaaggcatcaagccgacattaattatcgatgcggcttgtcatccttct
atcctgaaagaggccgtaacgctggcttctccagcggcacgtattgtattgatggggttc
tccagtgaaccgtctgaagtgattcagcaaggaattaccggaaaagaactctctattttc
tcttcacgcttaaatgcaaataaattcccgatcgttatcgactggttaagtaaagggtta
attaaaccagaaaaattaattacccatacgtttgatttccagcatgttgctgatgccatt
agtttatttgaacaggatcaaaaacattgctgcaaagtcttactcactttttctgaataa
              
                            

Download fasta file
RegulonDB