RegulonDB RegulonDB 10.9: Gene Sequence
rspA gene sequence


Size: 1215        A: 291  T: 308  G: 317  C: 299

Fasta

 

>rspA E. coli K12. Version NC_000913.3 GI:556503834
atgaagatcgtaaaggctgaagtttttgttacctgtccggggcgtaatttcgtcacatta
aaaatcaccactgaggacggtattacgggccttggggatgccaccctcaatggacgtgag
ctttccgtggcctcttatttgcaggatcacctttgtccgcagcttattggtcgcgatgcg
caccgtatcgaagatatctggcagtttttctataaaggtgcttactggcgtcgcggtccg
gttacgatgtcggccatttcagcggttgatatggcgctgtgggatattaaagccaaagct
gccaacatgccgctttaccagttactcggcggcgcgtctcgtgaaggggtgatggtttat
tgccataccaccggtcacagtattgatgaagctctggatgattatgcccgtcatcaagag
cttggattcaaagccatccgcgtgcagtgcggaatccctggtatgaaaaccacctacggc
atgtcgaaaggtaaaggtctggcttatgaacccgcaaccaaaggacagtggccggaagag
cagctgtggtcgacggagaaatacctcgatttcatgccgaaattgtttgacgcggtacgt
aacaagtttggttttaatgaacatttgctgcatgacatgcaccatcgcttaacgcctatt
gaagcggcgcgctttggtaaaagcattgaagattatcgcatgttctggatggaagacccg
acgcctgcggaaaaccaggaatgcttccgtctcattcgccaacataccgtcacacccatc
gcagtgggtgaagtcttcaacagcatctgggactgcaaacaactgattgaagagcaactc
atcgattatatccgcaccacgctgacccatgcaggcggaattaccggtatgcgccggatt
gccgattttgcttcgctgtatcaggtacgtactggctcacacggtccttccgatttgtca
ccagtctgcatggctgcggcgctgcactttgatctgtgggtccccaatttcggtgtccag
gaatacatgggttattccgaacaaatgctcgaagtcttcccgcacaactggactttcgat
aacggctatatgcatccgggagacaaaccgggtcttggtatcgaattcgatgaaaagctg
gcggcgaaatatccctatgaacctgcttatctaccagtcgcacgtctggaagatggcacg
ctgtggaactggtaa
              
                            

Download fasta file
RegulonDB