RegulonDB RegulonDB 10.9: Gene Sequence
ynfA gene sequence


Size: 327        A: 51  T: 107  G: 107  C: 62

Fasta

 

>ynfA E. coli K12. Version NC_000913.3 GI:556503834
atgattaaaacaacgttactattttttgctactgcgctgtgtgaaattattggatgcttt
ctgccctggttgtggttaaaacgaaacgccagtatctggctgttgcttccggcggggatt
tcactggcgctgtttgtctggttgttaacgttgcatccagcggcgagtgggcgtgtttac
gcggcttatggtggcgtttatgtctgcacggcgttgatgtggctgcgcgttgtggatggc
gtgaaactgactctttatgactggacgggtgcgttgattgcgctttgcggcatgttgatc
attgttgcgggctgggggcgcacgtag
              
                            

Download fasta file
RegulonDB