RegulonDB RegulonDB 10.9: Gene Sequence
ynfB gene sequence


Size: 342        A: 102  T: 65  G: 82  C: 93

Fasta

 

>ynfB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatcactctcagcaaacgaatcggcctgctcgctattctgctgccttgcgcactg
gcattgagcacaactgttcatgccgaaactaacaaactggtgattgagtctggcgacagt
gcacaaagccgccagcacgccgctatggaaaaagagcaatggaatgacacgcgcaatctg
cgccagaaagtgaataaacgcactgaaaaagagtgggataaagccgacgccgcttttgat
aaccgcgataaatgtgagcaaagcgccaacatcaatgcctactgggagcccaatactttg
cgctgcctggaccgtcgaactggccgcgttattaccccctaa
              
                            

Download fasta file
RegulonDB