RegulonDB RegulonDB 10.8: Gene Sequence
speG gene sequence


Size: 561        A: 153  T: 145  G: 137  C: 126

Fasta

 

>speG E. coli K12. Version NC_000913.3 GI:556503834
atgccaagcgcccacagtgttaagctacgcccgctggagcgtgaagatttacgctatgta
catcaactcgacaataacgccagtgtgatgcgttactggtttgaggaaccctacgaagcc
tttgttgaactctctgatctgtatgataagcatattcacgatcagagcgaacggcgcttt
gtggtggaatgtgacggcgaaaaagccggtctggtggagctggtggaaattaaccatgtt
catcgccgcgcagaatttcagataattatctccccggagtatcaggggaaaggtctggca
acccgtgccgccaaattagcaatggactatggctttaccgttctcaatctctataagctg
tatctgatcgttgataaagagaatgaaaaagcgattcacatttaccgcaagcttggcttt
tcggttgaaggtgaattgatgcacgagttctttattaatggtcaatatcgtaatgccatt
cgcatgtgtatattccagcatcagtatctggcagagcacaaaacaccgggtcagactctc
ctgaagccgaccgcacaatag
              
                            

Download fasta file
RegulonDB