RegulonDB RegulonDB 10.9: Gene Sequence
ynfC gene sequence


Size: 711        A: 220  T: 180  G: 168  C: 143

Fasta

 

>ynfC E. coli K12. Version NC_000913.3 GI:556503834
gtgaaatacaaattactaccatgcttactcgcgatattcctcacaggatgtgaccgcaca
gaggtaacactttcatttacccctgagatggccagtttctctaatgaattcgattttgat
ccgctgcgtggtccggtaaaagatttcactcagacattaatggatgagcaaggtgaagtg
acgaaacgtgtttctgggactttgtcggaagaaggctgttttgattcactcgaattactg
gatctggaaaataataccgtggtcgctctggtactggacgccaattattaccgtgatgcc
gagacgctggagaagagagtacgtttacagggaaaatgccagctagcagaattaccttct
gccggggtgagttgggaaaccgatgataatggcttcgtgattaaagccagcagcaaacaa
atgcagatggaatatcgctatgatgatcagggttatccgctgggtaaaaccacgaaaagt
aacgacaaaacattatctgtcagcgccacgccatcaacggatccgatcaaaaaattagat
tacacagcggttactttactgaataatcaacgggttggtaatgtaaaacagagctgtgaa
tatgacagtcacgctaatccggtggactgtcagctaatcattgttgatgaaggagtaaaa
cccgccgtcgaacgggtttacaccatcaaaaatacgatcgattattattaa
              
                            

Download fasta file
RegulonDB