RegulonDB RegulonDB 10.8: Gene Sequence
ynfD gene sequence


Size: 306        A: 69  T: 65  G: 71  C: 101

Fasta

 

>ynfD E. coli K12. Version NC_000913.3 GI:556503834
atgaaactctcaacctgctgtgccgcgcttctgctcgccctcgcctcacccgcggtactc
gccgcgccgggatcctgtgagcgcatacagagcgatatatcacagcgcattatcaataat
ggcgtacccgaaagcagcttcacgttaagtattgtacccaatgaccaggttgatcagcct
gattcccaggtcgtcggccattgcgctaatgatacgcataaaattctctatacccgcacc
accagcggtaacgtctctgctcccgcgcagtctagccaggatggcgcgcctgccgaaccg
cagtaa
              
                            

Download fasta file
RegulonDB