RegulonDB RegulonDB 10.9: Gene Sequence
ynfE gene sequence


Size: 2427        A: 660  T: 535  G: 603  C: 629

Fasta

 

>ynfE E. coli K12. Version NC_000913.3 GI:556503834
atgtccaaaaatgaacgaatggtgggcatcagccgcagaacactcgttaaatctaccgcg
ataggttctctggcgctggctgcaggcggtttttctttgccgtttaccctgcgcaatgca
gcagcagcggtacaacaggcccgcgaaaaagtggtctggggtgcctgttccgtcaactgt
ggtagccgctgtgcacttcgtctacatgttaaagataatgaagtgacctgggtggaaact
gacaataccggcagcgatgagtacggcaaccatcaggtacgcgcctgtttgcgcggtcgc
tccatccgccggcgtattaatcatcccgatcgcttgaattacccaatgaaacgcgtgggc
aaacgcggcgaaggcaaattcgaacggattagctgggatgaagccctggatactatcgcc
agtagcctgaagaaaaccgtcgaacaatatggcaatgaggctgtatatattcagtactct
tcggggatcgttggcggcaatatgacccgctcttcgccatcagcctcggcggtcaaacgc
ctgatgaactgctacggcggttcactcaaccagtatggctcctacagcactgcgcaaatt
tcctgtgccatgccctacacctacggcagtaatgatggcaacagcaccacggatattgaa
aacagcaagctggtcgtgatgtttggtaacaacccggcagaaacccgcatgagcggtggt
ggcatcacttatcttcttgaaaaagcgcgcgagaaatcgaacgccaaaatgattgttatc
gatccgcgatataccgatacggctgccggtcgtgaagacgaatggctccctattcgcccg
ggcaccgatgccgcgctggttgcgggtattgcctgggtattgattaacgaaaatctcgtt
gatcaaccttttctcgataaatactgcgtcggctatgacgaaaaaaccttacccgcagat
gcacccaaaaatggtcactataaagcctatattcttggtgaaggtgacgataaaacagcg
aaaacgccgcagtgggcttcgcaaattaccggtatcccggaggaccgtatcatcaaactg
gcgcgtgaaattggcacagcaaaacccgcttatatctgccagggctgggggccacaacgc
caggcaaacggcgaactgactgcacgcgctattgctatgttacctattttgacgggcaat
gtcggcatcagcggcggaaatagtggcgcgcgtgaatcgacctataccattaccatagaa
cgcctgccggtgctggataatccggtcaaaacgtcaatctcctgcttcagctggacagat
gctatcgatcatggtccgcaaatgacggcaatccgcgacggcgtccgcggcaaagataaa
ctggatgtgcccattaagttcatctggaactacgcgggaaataccctcgttaatcagcat
tctgacatcaacaaaacgcatgaaattctgcaggacgaatcgaaatgcgaaatgattgtg
gtcatcgaaaactttatgacctcatcggcaaaatatgccgacattctgctgccagacctg
atgaccgttgagcaggaagatattattcctaacgactacgccggtaacatgggatatctc
attttcctccagcctgtcaccagcgaaaaattcgaacgcaaaccgatttactggatcctg
agtgaagtcgcgaaacgtcttggacctgacgtctatcaaaagttcacagaaggtcgcacg
caggaacaatggttacaacatctgtacgccaaaatgcttgccaaagatccggcgttaccg
tcttacgacgaactgaaaaaaatgggtatctataagcgtaaagatcccaatggccatttt
gtcgcctacaaagcatttcgtgacgaccccgaggcaaatccacttaaaacgccttccggt
aagattgaaatttattccagcaggctggcggaaattgcccgtacctgggaactggaaaaa
gatgaagtgataagcccattgccagtttatgcctcaacctttgaaggctggaactcccct
gaacgtagaaccttcccactgcaactgtttggtttccattacaaatcccgtactcactcg
acctacggcaatattgatctcctgaaggctgcctgccgtcaggaggtgtggatcaaccct
atagatgcgcagaaacgtgggattgccaacggcgatatggtgcgggtgtttaaccatcgt
ggcgaagttcggctaccagccaaagtaacaccacgtattctccctggagttagcgctatg
ggccagggagcctggcacgaggccaatatgtctggcgataaaatcgaccatggcggctgt
gtgaatacgctaaccactctgcgcccttcaccactggcgaagggaaacccgcagcacact
aatctggtcgagatcgaaaaaatataa
              
                            

Download fasta file
RegulonDB