RegulonDB RegulonDB 10.9: Gene Sequence
dmsD gene sequence


Size: 615        A: 126  T: 161  G: 178  C: 150

Fasta

 

>dmsD E. coli K12. Version NC_000913.3 GI:556503834
atgacccatttttcacagcaagataatttttctgtcgcggcgcgcgtgttgggcgcgctg
ttttattacgctccagagagtgcggaagccgcacctctggttgcggtactcaccagtgac
ggctgggaaactcagtggcctctaccagaagcgtcattagcgccgctggtgacggctttt
cagacacagtgtgaagagactcacgcccaggcctggcagcgtttgtttgtcggcccgtgg
gcactgccgtctccgccgtgggggtcggtctggctggatcgcgaatctgtgctgtttggc
gattcaacattggcacttcgtcagtggatgcgcgagaaaggcattcagtttgaaatgaag
caaaacgaaccggaagatcattttggttcactgctgttgatggctgcgtggttggcggag
aatggtcgccagacagaatgcgaagaattgctggcatggcacctttttccgtggtcaaca
cgttttcttgatgtttttatcgaaaaagcagaacaccctttctaccgtgcactgggtgaa
ctggctcgcttaacgctggcgcaatggcaatcacaactgttaattcctgtcgcggttaaa
ccgctgtttcgatag
              
                            

Download fasta file
RegulonDB