RegulonDB RegulonDB 10.9: Gene Sequence
clcB gene sequence


Size: 1257        A: 231  T: 344  G: 350  C: 332

Fasta

 

>clcB E. coli K12. Version NC_000913.3 GI:556503834
atgttccaccgtctgcttatcgcaacagtcgtcggtattctcgcggcctttgccgttgcc
gggtttcgtcatgcgatgctgctactggagtggttgttcctcaataatgactccggcagt
ctggtcaatgcagcgacaaacctttccccctggcgacggttgctaactccggcgctcggc
ggactggcggcgggtttgttgctgatgggctggcagaaatttacccaacaacgccctcat
gcgccgaccgattatatggaagcgttgcaaaccgatggacagttcgattacgcagcaagc
ctggttaaatcgcttgcctctctgctggtagtaaccagcggcagtgcaattggtcgcgaa
ggtgcgatgattcttttagctgcccttgccgcctcctgttttgcccaacgttttacgcca
cgccaggagtggaaattatggatcgcctgtggggccgcggcgggaatggctgcggcctat
cgtgccccgcttgctggcagtttatttatagccgaagtgctgtttggcactatgatgttg
gcctctctcggcccggtgattatttccgccgtcgtggcattgctggttagcaatctgatt
aatcatagcgacgcgttactctacaacgtacaactctcagtgacggttcaggctcgtgac
tatgcgctgattatcagtacaggtgtgctggcaggtctgtgcggaccactgttgttaacg
ttaatgaacgcctgtcatcgtggatttgtgagtctcaaacttgcgccgccctggcaactg
gcactaggcgggttgatcgtgggtctgctttccctgttcacacctgcagtgtggggcaac
ggctatagcaccgtacaatcctttttaaccgccccaccactgttaatgatcattgccggg
atcttcctttgtaaactgtgtgccgtgctggcgagtagcggttccggcgcacccggtggg
gtctttacaccgacgctatttatcggtcttgccattggcatgttgtatggtcgtagcctg
ggattatggttccctgatggcgaagaaattacacttttactcggattgaccgggatggcg
acactgttggcggcgaccacgcacgcgccgattatgtcgacgttgatgatatgtgaaatg
accggggagtatcagctactccccggtttattgattgcctgcgtaattgcgtcggtaatt
tcgcggacgttacaccgtgactctatctaccgccagcacactgcgcagcatagctaa
              
                            

Download fasta file
RegulonDB