RegulonDB RegulonDB 10.9: Gene Sequence
ynfK gene sequence


Size: 696        A: 177  T: 156  G: 198  C: 165

Fasta

 

>ynfK E. coli K12. Version NC_000913.3 GI:556503834
atgctgaagcgtttctttattaccggtacagacacttctgtagggaaaacggtggtttcc
cgcgcattgctacaagcgttagcctcccagggaaaaacggttgcgggatataaacccgta
gcgaaggggagcaaagagacacccgaagggctgcgtaataaagatgccctggtgttgcag
agtgtttcaaccatcgaactgccttatgaagcagttaatcctatcgcgttaagcgaagaa
gaaagtagcgtggcgcacagttgcccaatcaattacaccctcatttcaaacggcctggca
aacctgaccgaaaaagtcgatcatgtcgtggtagaagggactggcggctggcgcagtctg
atgaatgatttgcgtccactctctgaatgggtagtgcaggaacaactgccggtgttgatg
gttgtcggtattcaggaaggttgcattaaccatgcactgctaacagctcaggcgatcgcc
aacgacgggctgccgctcattggctgggtggctaaccgaatcaacccaggactggcgcat
tatgcggaaatcattgatgtgctgggtaaaaaacttccggcaccgctcattggtgaactg
ccttatctgccgcgcgccgaacagcgtgaactggggcaatacatccgcttagctatgctg
cgcagtgtgctggcggtagatagagtcacggtgtaa
              
                            

Download fasta file
RegulonDB