RegulonDB RegulonDB 10.9: Gene Sequence
mlc gene sequence


Size: 1221        A: 284  T: 299  G: 341  C: 297

Fasta

 

>mlc E. coli K12. Version NC_000913.3 GI:556503834
gtggttgctgaaaaccagcctgggcacattgatcaaataaagcagaccaacgcgggcgcg
gtttatcgcctgattgatcagcttggtccagtctcgcgtatcgatctttcccgtctggcg
caactggctcctgccagtatcactaaaattgtccgtgagatgctcgaagcacacctggtg
caagagctggaaatcaaagaagcggggaaccgtggccgtccggcggtggggctggtggtt
gaaactgaagcctggcactatctttctctgcgcattagtcgcggggagattttccttgct
ctgcgcgatctgagcagcaaactggtggtggaagagtcgcaggaactggcgttaaaagat
gacttgccattgctggatcgtattatttcccatatcgatcagttttttatccgccaccag
aaaaaacttgagcgtctaacttcgattgccataaccttgccgggaattattgatacggaa
aatggtattgtacatcgcatgccgttctacgaggatgtaaaagagatgccgctcggcgag
gcgctggagcagcataccggcgttccggtttatattcagcatgatatcagcgcatggacg
atggcagaggccttgtttggtgcctcacgcggggcgcgcgatgtgattcaggtggttatc
gatcacaacgtgggggcgggcgtcattaccgatggtcatctgctacacgcaggcagcagt
agtctcgtggaaataggccacacacaggtcgacccgtatgggaaacgctgttattgcggg
aatcacggctgcctcgaaaccatcgccagcgtggacagtattcttgagctggcacagctg
cgtcttaatcaatccatgagctcgatgttacatggacaaccgttaaccgtggactcattg
tgtcaggcggcattgcgcggcgatctactggcaaaagacatcattaccggggtgggcgcg
catgtcgggcgcattcttgccatcatggtgaatttatttaacccacaaaaaatactgatt
ggctcaccgttaagtaaagcggcagatatcctcttcccggtcatctcagacagcatccgt
cagcaggcccttcctgcgtatagtcagcacatcagcgttgagagtactcagttttctaac
cagggcacgatggcaggcgctgcactggtaaaagacgcgatgtataacggttctttgttg
attcgtctgttgcagggttaa
              
                            

Download fasta file
RegulonDB