RegulonDB RegulonDB 10.9: Gene Sequence
ynfL gene sequence


Size: 894        A: 191  T: 232  G: 247  C: 224

Fasta

 

>ynfL E. coli K12. Version NC_000913.3 GI:556503834
atgaatattgaacttcgtcatctgcgttactttgttgctgttgcggaagagctgcatttc
gggcgcgccgctgcccgcctgaatatttcgcaaccgccgctaagtcagcagattcaggcg
ctggagcaacaaattggtgcccgactgctggcacgaaccaatcgcagtgtattgctgacg
gcagcaggaaaacagtttcttgcagatagtcggcaaatcctgtctatggtggatgacgct
gccgctcgcgctgaaaggctgcatcagggtgaagcgggggagttgcgcattggttttact
tcgtcggctccttttattcgggcggtgtccgatacgttatcgctgtttcgccgtgattat
cctgatgtccatttacaaacccgcgaaatgaacactcgcgagcaaatcgctccgctcatt
gaaggaacgctggatatgggattgctgcgtaacacagcgttaccggagtcgcttgaacac
gcagtcatcgtccatgaaccgcttatggcgatgatcccgcacgatcatcccctggcaaat
aacccgaatgtaacgctggctgaactggcgaaagaaccctttgtcttttttgatccgcac
gtcgggacagggctgtatgacgatattctcgggctgatgcgacgttaccatttgacgccc
gtcatcactcaggaggtgggcgaggcaatgaccatcatcggtctggtttccgccggtctg
ggtgtttcaattttgcctgcgtcatttaaacgtgttcagctcaacgaaatgcgctgggtg
ccgattgctgaagaggatgcggtttctgaaatgtggttggtctggccgaaacatcatgaa
caaagtccggctgcgcgtaactttcgtattcatctgctgaatgctctcaggtga
              
                            

Download fasta file
RegulonDB