RegulonDB RegulonDB 10.9: Gene Sequence
asr gene sequence


Size: 309        A: 109  T: 42  G: 67  C: 91

Fasta

 

>asr E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaagtattagctctggttgttgccgctgctatgggtctgtcttctgccgccttt
gctgcagagactacgaccacacctgctccgactgcgacgaccaccaaagcagcgccggcg
aaaactacacatcataaaaaacagcataaagcagcacctgcccagaaagcgcaggcggct
aaaaagcatcataaaaatacgaaagctgaacagaaagcccctgaacaaaaagcgcaggca
gcgaagaaacacgccaagaaacacagccatcagcaaccggcaaaacctgctgcacaaccc
gcagcgtaa
              
                            

Download fasta file
RegulonDB