RegulonDB RegulonDB 10.9: Gene Sequence
ydgH gene sequence


Size: 945        A: 254  T: 208  G: 242  C: 241

Fasta

 

>ydgH E. coli K12. Version NC_000913.3 GI:556503834
atgaagcttaagaacaccctcctggcgtcggcactgctttctgctatggcattctccgtt
aacgcagcaacagaactgacaccggagcaagcggcagcggttaaaccttttgaccgtgta
gtggttaccggtcgttttaatgctattggcgaagcggtgaaagccgtttctcgtcgcgca
gataaagaaggtgccgcctctttttatgttgtcgacacttctgattttggtaacagcggt
aactggcgtgtggtcgctgacctctataaagccgatgctgaaaaagcagaagaaacaagt
aatcgcgtaattaacggtgttgtcgaactgccgaaagatcaggctgttctgattgaaccg
tttgacacggtcaccgtccagggcttctatcgtagccagccagaagtcaatgatgccatc
accaaagcggcaaaagcgaaaggtgcctactctttctacatcgttcgtcaaatcgatgcc
aaccagggcggcaaccagcgtattactgcattcatctataaaaaagatgctaagaaacgt
atcgtccagagcccggatgtgatcccggcagattccgaagcaggacgtgcagctctggct
gccggtggcgaagccgcgaagaaagttgagatcccgggtgttgcgactaccgcatcacca
agttctgaagtcggtcgcttctttgaaacccagtcatcaaaaggcgggcgttacaccgtc
acgctcccggatggcactaaagtcgaagaactgaacaaagcgaccgcagcgatgatggtc
ccgttcgacagcatcaaattctctggcaactacggcaacatgaccgaagtctcctatcag
gttgcgaaacgtgccgcgaagaaaggtgctaagtattaccacatcacccgccagtggcag
gaacgtggtaataacctgaccgtcagcgcagatctgtataaataa
              
                            

Download fasta file
RegulonDB