RegulonDB RegulonDB 10.9: Gene Sequence
ydgI gene sequence


Size: 1383        A: 256  T: 387  G: 389  C: 351

Fasta

 

>ydgI E. coli K12. Version NC_000913.3 GI:556503834
atggaaaagaaactgggactgagcgcactcaccgcgctggtattaagctcaatgctgggc
gcgggtgttttcagtctgccgcaaaatatggcggcagttgccagcccggcagcactgctc
atcggctggggtattactggcgctggcattttattgctggcctttgccatgctgatcctc
acgcgcattcgtcccgaacttgacggcggtatctttacctatgcccgcgaagggtttggc
gagctaatcggcttttgttccgcatggggatactggctgtgcgcagtcatcgccaacgtc
tcctatctggtgatcgttttttccgcgttaagcttttttacggacacgccggaattgcgc
ctgtttggcgatggtaatacctggcaatcgatagtcggtgcatcggctttattgtggatt
gttcactttttgatcctgcgcggggtgcaaaccgctgccagcattaacctggtggcgaca
ctggcaaaattgttgccgctgggtctgtttgttgtgctggcgatgatgatgttcaaactg
gataccttcaagctcgacttcaccggacttgcacttggcgtacccgtttgggaacaggtg
aaaaacaccatgctgatcaccctgtgggttttcattggtgtggaaggtgccgtggttgtt
tctgcgcgtgcgcgtaataaacgtgatgttggcaaagcgacactgctggcggttctctcc
gctctgggcgtttacttgctggtaacgctgctttcgctgggtgtggtggcacgtcctgaa
ctggctgaaattcgtaacccgtcaatggccggtctgatggtggaaatgatgggaccatgg
ggcgaaatcatcatcgctgccggtttgatcgtttccgtttgcggcgcgtacttaagctgg
accatcatggcagcagaagtaccgttcctggccgccactcataaagcattcccgcgcatt
tttgcgcgccagaacgcacaagctgcgccatccgcctcactgtggttgaccaacatctgc
gtgcaaatttgtctggtactcatctggctgaccggttccgattacaacacgttgctgacc
atcgcctcagaaatgattctggtgccctatttcctggtcggcgcgttcttgctgaaaatc
gcaacccgtccactgcataaagcggtaggtgtcggtgcctgcatttatggcttatggtta
ttgtacgcctctggtccaatgcacttgctgttatccgttgttctgtatgcaccggggctg
ctggttttcctgtacgcgcgcaaaacgcatacccatgataatgtactgaaccgtcaggaa
atggtgctgattggcatgctgttaattgcctcagttccggcgacctggatgctggtggga
taa
              
                            

Download fasta file
RegulonDB