RegulonDB RegulonDB 10.9: Gene Sequence
ydgC gene sequence


Size: 336        A: 65  T: 112  G: 90  C: 69

Fasta

 

>ydgC E. coli K12. Version NC_000913.3 GI:556503834
atggggctggtaatcaaagccgcgctcggtgcgctggtagtgctgttgattggtgtttta
gcaaaaacgaaaaattattatatcgccgggctgattccacttttcccgacctttgcgctt
atcgcgcattatattgttgccagcgaacgcggcattgaagccttacgcgcaaccatcatt
tttagtatgtggtcgattattccctattttgtttacctggtgtcgctgtggtatttcacc
ggaatgatgcgcttgcccgccgcttttgttggttctgttgcgtgttgggggataagcgca
tgggtgttgattatatgctggataaagctgcattaa
              
                            

Download fasta file
RegulonDB