RegulonDB RegulonDB 10.9: Gene Sequence
rstA gene sequence


Size: 720        A: 186  T: 179  G: 174  C: 181

Fasta

 

>rstA E. coli K12. Version NC_000913.3 GI:556503834
atgaacactatcgtatttgtggaagatgatgcggaagtcggttcactgattgccgcgtac
ctggcaaaacatgatatgcaggttaccgtagagccgcgcggcgaccaggccgaagaaacc
attttgcgagaaaatccggatttggtgttactcgacatcatgctaccaggcaaggacggc
atgaccatttgtcgtgatttacgcgcaaagtggtctggaccgattgttcttctaacctct
ctcgatagcgatatgaaccacatcctggcactggaaatgggtgcctgcgactatattctc
aaaacgacgccccctgctgttttgctagcgcgtttacgtttgcatttgcgtcagaatgag
caagccacactgaccaaaggtcttcaggaaacgtctctgactccctacaaagccctgcat
ttcggcacgttgaccatcgatcccatcaaccgcgtagtcaccctggctaacactgaaatc
tcgctctcgacagctgatttcgaattattgtgggaattagctacccatgccgggcaaatc
atggaccgcgatgcattgctgaaaaatttacgcggcgtcagttatgacggactggatcgt
agcgtggacgtggctatttcgcggttaagaaaaaaactgctcgataacgccgcagaacct
tatcgcattaaaactgtgcgtaacaaaggctatctttttgcgcctcatgcatgggaataa
              
                            

Download fasta file
RegulonDB