RegulonDB RegulonDB 10.9: Gene Sequence
ydgA gene sequence


Size: 1509        A: 448  T: 321  G: 395  C: 345

Fasta

 

>ydgA E. coli K12. Version NC_000913.3 GI:556503834
atgaataaatcgctggtagcggtaggcgtcattgttgcgctaggcgtagtctggacaggc
ggcgcatggtatacaggcaagaagattgaaacccatctcgaagacatggtcgcgcaggcg
aacgcgcaactcaaactgacagctcctgaatccaacctggaagtgagttatcaaaactat
catcgcggcgtattcagcagccagttgcaactgttggtgaaacccattgccgggaaagaa
aatccgtggattaaaagcggtcagagcgtcatcttcaacgaatcggttgatcatggtccc
ttcccgcttgcccagcttaaaaaactgaacctgatcccgtcgatggcatcaattcaaacc
acgctggttaataacgaagtaagcaaaccactgtttgatatggcaaaaggtgaaacgcct
tttgagattaactcgcgcattggttacagcggtgattccagttccgatatttcgctcaag
ccactgaattacgagcaaaaggatgaaaaagtcgcctttagcggcggcgagttccagtta
aatgctgacagagacggcaaagccatctccctttccggggaggcgcaaagtggtcggata
gacgcagttaacgaatacaaccagaaagtgcagttgacctttaataatctgaaaaccgac
ggttccagcacgctggcaagttttggtgagcgtgtaggaaatcaaaaactgtcactggaa
aaaatgaccatttcagtggaaggcaaagaactggcactgctggaaggcatggagatcagc
ggtaaatcggatctggtcaatgacggtaaaacgatcaatagccaactggattactcgcta
aacagcctgaaggtacagaatcaggatctgggcagcggcaagctgactttaaaagtcggc
cagattgatggtgaagcctggcatcagtttagccagcaatataacgcgcaaactcaggcg
ctgctggcacagccagaaattgccaacaaccccgaactttatcaggagaaagtgacggaa
gccttctttagcgccctgccgctgatgctgaaaggcgatccggtgattactatcgcgccg
ctaagctggaaaaacagtcagggtgaaagtgccctgaatctgtcgctgttcctgaaagat
ccggcaacgactaaagaagcgccgcaaacgctggcgcaggaagtagatcgttcggttaaa
tctctggatgcgaaactgaccattccggtggatatggcaactgagtttatgactcaggta
gcgaagctggaaggttatcaggaagatcaagcgaaaaaactggcgaaacagcaagttgaa
ggtgcatcagcaatggggcagatgttccgtctgaccaccttgcaggacaataccatcacc
accagcctgcaatatgctaacggtcagataacgttaaatgggcagaaaatgtcgttagaa
gattttgttggcatgtttgcgatgccagctcttaacgttccggctgtaccggcaattccg
cagcagtaa
              
                            

Download fasta file
RegulonDB