RegulonDB RegulonDB 10.9: Gene Sequence
uidC gene sequence


Size: 1266        A: 325  T: 344  G: 356  C: 241

Fasta

 

>uidC E. coli K12. Version NC_000913.3 GI:556503834
atgagaaaaatagtggccatggccgttatttgcctgacggctgcctctggccttacctct
gcttatgcggcgcaactggctgacgatgaagcgggactacgcatcagactgaaaaacgaa
ttgcgcagggcggataagcccagtgctggcgcgggaagagatatttacgcatgggtacag
ggaggattgctcgatttcaatagtggttattattccaatattattggcgttgaaggcggg
gcgtattatgtttataaattaggtgctcgtgctgatatgagtacccggtggtatcttgat
ggtgataaaagttttggctttgccctgggggcagtaaaaataaaacccagtgaaaatagc
ctgcttaaattaggtcgcttcgggacggattatagttatggtagcttaccttatcgtatt
ccgttaatggctggcagttcgcaacgtacattaccgacagtttctgaaggagcattaggt
tattgggctttaacaccaaatattgatctgtggggaatgtggcgttcacgagtattttta
tggactgattcaacaaccggtattcgtgatgaaggggtgtataacagccagacgggaaaa
tacgataaacatcgcgcacgttcttttttagccgccagttggcatgatgataccagtcgc
tattctctgggggcatcggtacagaaagatgtttccaatcagatacaaagtattctcgag
aaaagcataccgctcgacccgaattatacgttgaaaggggagttgctcggcttttacgcg
cagctcgaaggtttaagtcgtaataccagccagcccaatgaaacggcgttggttagtgga
caattgacctggaatgcgccgtggggaagtgtatttggcagtggtggttatttgcgccat
gcaatgaatggtgccgtggtggataccgacattggctatcccttttcattaagtcttgat
cgtaaccgtgaaggaatgcagtcctggcaattgggcgtcaactatcgtttaacgccgcaa
tttacgctgacatttgcaccgattgtgactcgcggctatgaatccagtaaacgagatgtg
cggattgaaggcacgggtatcttaggtggtatgaactatcgggtcagcgaagggccgtta
caagggatgaatttctttcttgctgccgataaagggcgggaaaagcgcgatggcagtacg
ctgggcgatcgcctgaattactgggatgtgaaaatgagtattcagtatgactttatgctg
aagtaa
              
                            

Download fasta file
RegulonDB