RegulonDB RegulonDB 10.9: Gene Sequence
uidR gene sequence


Size: 591        A: 153  T: 137  G: 155  C: 146

Fasta

 

>uidR E. coli K12. Version NC_000913.3 GI:556503834
atgatggataacatgcagactgaagcacaaccgacacggacccggatcctcaatgctgcc
agagagattttttcagaaaatggatttcacagtgcctcgatgaaagccatctgtaaatct
tgcgccattagtcccgggacgctctatcaccatttcatctccaaagaagccttgattcag
gcgattatcttacaggaccaggagagggcgctggcccgtttccgggaaccgattgaaggg
attcatttcgttgactatatggtcgagtccattgtctctctcacccatgaagcctttgga
caacgggcgctggtggttgaaattatggcggaagggatgcgtaacccacaggtcgccgcc
atgcttaaaaataagcatatgacgatcacggaatttgttgcccagcggatgcgtgatgcc
cagcaaaaaggcgagataagcccagacatcaacacggcaatgacttcacgtttactgctg
gatctgacctacggtgtactggccgatatcgaagcggaagacctggcgcgtgaagcgtcg
tttgctcagggattacgcgcgatgattggcggtatcttaaccgcatcctga
              
                            

Download fasta file
RegulonDB