RegulonDB RegulonDB 10.9: Gene Sequence
rsxC gene sequence


Size: 2223        A: 562  T: 430  G: 625  C: 606

Fasta

 

>rsxC E. coli K12. Version NC_000913.3 GI:556503834
atgcttaagttattctctgcattcagaaaaaataaaatctgggatttcaacggcggcatc
catccaccggagatgaaaacccagtccaacggtacacccctgcgccaggtacccctggcg
cagcgttttgttattccactgaaacagcatattggcgctgaaggtgagttgtgcgttagc
gtcggcgataaagtattgcgcggccagccgcttacccgtggtcgcggcaaaatgctgcct
gttcacgcgcccacctcgggtaccgttacggctattgcgccccactctacggctcatcct
tcagctttagctgaattaagcgtgattattgatgccgatggtgaagactgctggatcccg
cgcgacggctgggccgattatcgcactcgcagtcgcgaagagttaatcgagcgcatacat
cagtttggtgttgccgggctgggcggtgcaggattcccgacaggcgttaaattgcagggt
ggcggagataagattgaaacgttgattatcaacgcggctgagtgcgagccgtacattacc
gccgatgaccgtttgatgcaggattgcgcggctcaggtcgtagagggtattcgcattctt
gcgcatattctgcagccacgcgaaattcttatcggcattgaagataacaaaccgcaggcg
atttccatgctgcgcgcggtgctggcggactctaacgatatttctctgcgggtgattcca
accaaatatccttctggcggtgctaaacaattaacctacattctgaccgggaagcaggtt
ccacatggcgggcgttcatccgatatcggcgtattaatgcaaaacgtcggcactgcttat
gcagtgaaacgtgccgttattgatggcgagccgattaccgagcgtgttgtaaccctgact
ggcgaagcaatcgctcgcccgggcaacgtctgggcacggctggggacgccagtgcgtcat
ttattgaatgatgccggattctgcccctctgccgatcaaatggtgattatgggtggcccg
ctaatgggctttaccttgccatggctggatgtcccggtcgtaaagattaccaactgtctg
ttggctccctctgccaatgaacttggcgaaccacaggaagaacaaagctgcatccggtgt
agcgcctgtgctgacgcctgccctgcggatcttttgccgcaacagttgtactggttcagc
aaaggtcagcaacacgataaagctaccacgcataacattgctgattgcattgaatgtggg
gcttgcgcgtgggtttgcccgagcaatattcccctggtgcaatatttccgtcaggaaaaa
gctgaaattgcggctattcgtcaggaagaaaagcgcgccgcagaagccaaagcgcgtttc
gaagcgcgccaggctcgtctggagcgcgaaaaagcggctcgccttgaacgacataagagc
gcagccgttcaacctgcagccaaagataaagatgcgattgctgccgctctggcgcgggtg
aaagagaaacaggcccaggctacacagcctattgtgattaaagcgggcgaacgcccggat
aacagtgcaattattgcagcacgggaagcccgtaaagcgcaagccagagcgaaacaggca
gaactgcagcaaactaacgacgcagcaaccgttgctgatccacgtaaaactgccgttgaa
gcagctatcgcccgcgccaaagcgcgcaagctggaacagcaacaggctaatgcggaacca
gaacaacaggtcgatccgcgcaaagccgccgtcgaagccgctattgcccgtgccaaagcg
cgcaagctggaacagcaacaggctaatgcggaaccagaagaacaggtcgatccgcgcaaa
gccgccgtcgaagccgctattgcccgtgccaaagcacgcaagctggaacagcaacaggct
aatgccgagccagaacaacaggtcgatccgcgcaaagccgccgtcgaagccgctattgcc
cgagccaaagcgcgcaaacgggaacagcaaccggctaatgcggagccagaagaacaggtt
gatccgcgcaaagctgccgtcgaagcggctattgcacgcgccaaagcacgcaagctggaa
cagcaacaggctaatgcggtaccagaagaacaggttgatccgcgcaaagcggcagttgcc
gcggctattgcccgcgctcaggccaaaaaagccgcccagcagaaggttgtaaacgaggac
taa
              
                            

Download fasta file
RegulonDB