RegulonDB RegulonDB 10.9: Gene Sequence
rsxD gene sequence


Size: 1059        A: 206  T: 296  G: 284  C: 273

Fasta

 

>rsxD E. coli K12. Version NC_000913.3 GI:556503834
atggtattcagaatagctagctccccttatacccataaccagcgccagacatcgcgcatt
atgctgttggtgttgctcgcagccgtgccaggaatcgcagcgcaactgtggttttttggt
tggggtactctcgttcagatcctgttggcatcggttagtgctctgttagccgaagctctc
gtactcaaactacgcaagcagtcggtagccgcaacgttgaaagataactcagcattgctg
acaggcttattgctggcggtaagtattccccccctcgcgccatggtggatggtcgtgctg
ggtacggtgtttgcggtgatcatcgctaaacagttgtatggcggtctgggacaaaacccg
tttaatccggcaatgattggttatgtggtcttactgatctccttccccgtgcagatgacc
agctggttaccgccacatgaaattgcggtcaacatccctggttttatcgacgccatccag
gttatttttagcggtcataccgccagtggtggtgatatgaacacactacgcttaggtatt
gatggcattagtcaggcgacaccgctggatacatttaaaacctctgtccgtgccggtcat
tcggttgaacagattatgcaatatccgatctacagcggtattctggcgggcgctggttgg
caatgggtaaatctcgcctggctggctggcggcgtatggttgctatggcagaaagcgatt
cgctggcatattcccctcagcttcttagtaacgctggcgttatgcgcaatgttgggctgg
ttgttctcaccagaaacactggcagcaccgcaaattcatctgctgtctggagcgaccatg
ctcggcgcattctttattttgactgacccggttaccgcttctacgaccaatcgtggtcgt
cttattttcggcgcgcttgcgggcttattagtctggttgatccgcagtttcggcggctat
cctgacggcgtggcttttgccgtcctgctggcgaacatcacggttcctctgatcgattac
tacacgcgtccgcgcgtctacggccatcgcaaagggtaa
              
                            

Download fasta file
RegulonDB