RegulonDB RegulonDB 10.9: Gene Sequence
rsxG gene sequence


Size: 621        A: 161  T: 130  G: 175  C: 155

Fasta

 

>rsxG E. coli K12. Version NC_000913.3 GI:556503834
atgctgaaaactatccgaaaacacggcattacgttggcgctatttgcagcgggttcaaca
gggttaactgcggccatcaaccagatgaccaaaacgacgattgctgaacaggccagtctg
caacaaaaggcgttatttgatcaggtgctgccagccgaacgctataacaatgcgctggca
cagagttgctatctggtaactgcgccagagttaggtaaaggtgagcatcgggtttacatc
gccaaacaggatgacaaaccggtagccgccgttctggaagcaaccgcgccagatggctat
tccggtgcgattcagctgctggtgggagccgattttaacggcacggtacttggcacgcgc
gtgacagagcaccacgaaacgccagggcttggcgataaaatcgaactgcgcctttctgac
tggatcacccattttgcgggtaaaaaaatcagtggtgcagatgatgcgcactgggcggtg
aagaaagatggtggtgatttcgaccagttcaccggcgcgacgattactccccgcgcggtg
gttaatgcggtaaaacgcgccggattgtacgctcagacgttaccggcacaactttctcaa
cttcctgcctgtggagaataa
              
                            

Download fasta file
RegulonDB