RegulonDB RegulonDB 10.9: Gene Sequence
rsxE gene sequence


Size: 696        A: 150  T: 179  G: 191  C: 176

Fasta

 

>rsxE E. coli K12. Version NC_000913.3 GI:556503834
gtgagcgaaattaaagacgttattgttcaggggttgtggaaaaacaactctgcgctggtc
cagttgctcggcctttgtcctctgttggcggtcacgtccactgccactaacgctctgggt
ttaggacttgcgactacgctggtactgacgctgaccaacctgaccatttcgacgctgcgt
cactggacgccagccgagatccgcattcccatttacgtgatgatcatcgcctcggtggtc
agcgctgtacagatgctgatcaacgcctacgcctttggcctgtatcaatcattagggatt
tttattccgctgattgtcactaactgtatcgttgtgggccgcgctgaagccttcgccgcc
aaaaaaggtccggcgctttcggcactggacggcttttcaattggtatgggcgcaacctgc
gccatgttcgtgctgggttcactacgcgaaattatcggcaatggcacattgtttgacggt
gcagatgcgctgttaggtagctgggcaaaagtattacgcgtggagattttccacaccgac
tcccctttcctgctggcgatgctgccaccaggtgcatttattggcctgggactgatgctg
gcaggaaaatacctgattgatgaaagaatgaaaaagcgccgtgctgaagcagctgcagaa
cgtgcattgccaaacggtgaaacagggaatgtctga
              
                            

Download fasta file
RegulonDB