RegulonDB RegulonDB 10.9: Gene Sequence
dtpA gene sequence


Size: 1503        A: 299  T: 428  G: 408  C: 368

Fasta

 

>dtpA E. coli K12. Version NC_000913.3 GI:556503834
gtgtccactgcaaaccaaaaaccaactgaaagcgtcagtttgaacgctttcaaacaaccg
aaggcgttctatctcatcttctcgattgagttatgggaacgttttggttattacggccta
caaggaattatggctgtttacctggttaaacaactgggtatgtctgaagcggattcaatc
acccttttctcttcctttagtgccctggtttatggtctggtcgctatcggcggctggtta
ggtgacaaggtactgggtactaaacgcgtaattatgctcggcgctattgtgctggcgatt
ggttatgctctggttgcctggtctggtcacgacgccggtatcgtttatatgggtatggcg
gctattgcggtcggtaacggcctgtttaaagctaacccgtcttctctgctttctacatgc
tatgagaaaaacgacccgcgtctggacggtgcattcaccatgtactacatgtccgtcaac
atcggctctttcttctctatgattgctacgccgtggctggccgcgaaatacggctggagt
gttgcgtttgcgttgagcgttgtaggcctgctgatcactatcgttaacttcgccttctgc
caacgctgggttaaacagtacggttcaaaaccagacttcgagcctatcaactaccgtaac
ctgctgctgaccattattggtgttgtggcactgatcgctatcgccacctggctgctgcac
aatcaggaagttgcgcgtatggcgctgggcgttgttgccttcggtatcgtggttatcttc
ggtaaagaagccttcgcgatgaaaggtgctgcgcgtcgtaaaatgatcgttgccttcatc
ctgatgctcgaagccattatcttcttcgtgctgtacagccagatgccaacgtcactgaac
ttctttgcgattcgtaacgttgagcactccattctgggtctggccgtagaacctgagcag
tatcaggcactgaacccgttctggatcatcatcggtagtccgattctggccgctatctat
aacaagatgggcgataccctgccgatgccaaccaagtttgcaatcggcatggtgatgtgt
tctggtgcgttcctgattctgccgctgggtgcgaaattcgcgtctgacgctggtatcgtg
tctgtaagctggctggtcgcaagctatggcctgcagagcatcggggaactgatgatctct
ggtctgggtctggcaatggttgctcaactcgttccgcagcgtctgatgggcttcattatg
ggtagctggttcctgaccactgccggtgcaaacctgattggtggttatgttgcgggtatg
atggctgtgccggataacgttaccgatccgctgatgtcactggaagtctatggtcgcgta
ttcttgcagattggtgtcgctactgccgttattgcagtactgatgctgctgaccgcgccg
aaactgcaccgcatgacgcaggatgacgctgcagacaaagcggcgaaagcagccgtagcg
taa
              
                            

Download fasta file
RegulonDB