RegulonDB RegulonDB 10.9: Gene Sequence
gstA gene sequence


Size: 606        A: 158  T: 142  G: 161  C: 145

Fasta

 

>gstA E. coli K12. Version NC_000913.3 GI:556503834
atgaaattgttctacaaaccgggtgcctgctctctcgcttcccatatcaccctgcgtgag
agcggaaaggattttaccctcgtcagtgtggatttaatgaaaaaacgtctcgaaaacggt
gacgattactttgccgttaaccctaaggggcaggtgcctgcattgctgctggatgacggt
actttgctgacggaaggcgtagcgattatgcagtatcttgccgacagcgtccccgaccgc
cagttgctggcaccggtaaacagtatttcccgctataaaaccatcgaatggctgaattac
atcgccaccgagctgcataaaggtttcacacctctgtttcgccctgatacaccggaagag
tacaaaccgacagttcgcgcgcagctggagaagaagctgcaatatgtgaacgaggcactg
aaggatgagcactggatctgcgggcaaagatttacaattgctgatgcctatctgtttacg
gttctgcgctgggcatacgcggtgaaactgaatctggaagggttagagcacattgcagca
tttatgcaacgtatggctgaacgtccggaagtacaagacgcgctgtcagcggaaggctta
aagtaa
              
                            

Download fasta file
RegulonDB