RegulonDB RegulonDB 10.9: Gene Sequence
pdxY gene sequence


Size: 864        A: 204  T: 202  G: 250  C: 208

Fasta

 

>pdxY E. coli K12. Version NC_000913.3 GI:556503834
atgatgaaaaatattctcgctatccagtctcacgttgtttatggtcatgcgggtaacagt
gcggcagagtttccgatgcgccgcctgggcgcgaacgtctggccgctgaacaccgttcaa
ttttctaatcacacccaatacggcaaatggactggctgcgtgatgccgcccagccattta
accgaaattgtgcaaggcattgccgccattgataaattacacacctgtgatgccgtatta
agtggctatctgggatcggcggagcagggtgaacatatcctcggtatcgtccgtcaggtg
aaagccgcgaatccgcaggcgaaatatttttgcgatccggtaatgggtcatccggaaaaa
ggctgtatcgttgcaccgggtgtcgcagagtttcatgtgcggcacggtttgcctgccagc
gatatcattgcgccaaatctggttgagctggaaatactctgtgagcatgcggtaaataac
gtcgaagaagcggttctggcagcgcgcgaactcattgcgcaagggccacaaattgtgttg
gttaaacacctggcgcgagctggctacagccgtgaccgttttgaaatgctgctggtcacc
gccgatgaagcctggcatatcagccgtccgctggtggattttggtatgcgccagccggta
ggtgttggtgatgtgacgagcggtttactgctggtgaaactgcttcagggggcaacgctg
caggaggcgctggaacatgtgaccgctgcagtctacgaaatcatggtgaccaccaaagca
atgcaggaatatgagctgcaagtggtggctgctcaggatcgtattgccaaaccagaacat
tacttcagcgcaacaaagctctga
              
                            

Download fasta file
RegulonDB