RegulonDB RegulonDB 10.9: Gene Sequence
ydhJ gene sequence


Size: 858        A: 225  T: 202  G: 211  C: 220

Fasta

 

>ydhJ E. coli K12. Version NC_000913.3 GI:556503834
atgtcaattaaaacaattaagtatttctcaacaatcattgtagcggtagttgcggttctt
gccggatggtggctgtggaattattacatgcaatctccgtggacacgcgacgggaaaata
cgcgcagaacaggtttctatcaccccacaggtgtcgggacgtattgttgagctgaatata
aaagacaaccagctggttaacgcgggggatcttctgctcacgatcgataaaacgcccttt
cagatcgccgagctgaacgcacaggctcagctggcgaaagcgcaatctgacctcgcaaaa
gccaataacgaagcgaatcgtcgtcgtcatctctcacaaaattttatttctgccgaagaa
ctcgataccgctaacctcaatgttaaagcgatgcaggccagtgttgatgccgcacaggcg
acgctgaaacaggcacaatggcaactggcgcaaacggaaattcgcgccccggtgagtgga
tgggtgactaaccttactacccgcatcggcgattacgctgataccgggaaaccgctgttt
gcccttgtcgacagccactcgttttacgtcattggttattttgaagaaaccaagttgcgc
catatccgcgaaggtgcaccagcacaaattaccctctatagtgataacaaaacgttacag
ggtcacgtttccagtatcggtcgggcgatttatgatcagagcgttgaaagtgactcaagc
cttattccggatgttaaacctaacgtcccctgggttcgactcgcccaacgcgttcccgtc
cgctttgcgctggataaagtcccaggcgatgtcacgttggtgtcgggcaccacctgtagc
attgccgtaggtcaataa
              
                            

Download fasta file
RegulonDB