RegulonDB RegulonDB 10.9: Gene Sequence
ydhK gene sequence


Size: 2013        A: 405  T: 546  G: 531  C: 531

Fasta

 

>ydhK E. coli K12. Version NC_000913.3 GI:556503834
atgaacgcatcgtcatggtccttgcgcaatttgccctggttcagggccacgctggcgcaa
tggcgttatgcgttacgcaataccattgccatgtgtctggcgctgacggttgcctattat
ttaaatctggatgaaccctattgggcgatgacctcggctgcagtggttagctttcccacc
gttggcggtgttatcagcaaaagcctcggacgcatcgctggcagtttgctcggagccatt
gcggcactgcttcttgccgggcatacgctcaatgagccgtggttttttctattgagcatg
tcggcgtggcttggcttttgtacctgggcctgtgcgcacttcacgaataacgtcgcgtat
gcatttcaactggcgggctacacggctgccatcatcgcctttccgatggttaatattact
gaggccagccagctgtgggatatcgctcaggcgcgcgtttgcgaggtaatagtcggtatt
ttgtgcggcggcatgatgatgatgatcctgccgagcagttccgatgctactgccctttta
accgcattgaaaaacatgcacgcccgattactggaacatgccagtttactctggcagcct
gaaacaaccgatgccattcgtgcagcacatgaaggggtgattgggcagatactgaccatg
aatttgctgcgtatccaggctttctggagccactatcgttttcgccagcaaaacgcgcgc
cttaatgcgctgctccaccagcaattacgtatgaccagtgtcatctccagcctgcgacgt
atgttgctcaactggccctcaccgccaggtgccacacgagaaattctcgaacagttgctg
acggcgctcgccagttcgcaaacagatgtttacaccgtcgcacgtattatcgccccgcta
cgcccgaccaacgtcgccgactatcggcacgtcgccttctggcagcgactacgttatttt
tgccgcctttatctgcaaagtagtcaggaattacatcgtctgcaaagcggtgtagatgat
cataccagactcccacggacatccggcctggctcgtcataccgataacgccgaagctatg
tggagcgggctgcgtacattttgtacgttgatgatgattggcgcatggagtattgcttcg
caatgggatgccggtgccaatgcattaacgctggcagcaattagctgcgtactctactcc
gccgtcgcagcaccgtttaagtcgttgtcacttctgatgcgcacgctggtgttactttcg
ctattcagctttgtggtcaaatttggtctgatggtccagattagcgatctgtggcaattt
ttactgtttctctttccactgctggcgacaatgcagcttcttaaattgcagatgccaaaa
tttgccgcattgtgggggcaactgattgtttttatgggttcttttatcgctgtcactaat
cccccggtgtatgattttgctgattttcttaacgataatctggcaaaaatcgttggcgtc
gcgttggcgtggttagcgttcgccattctgcgtccaggatcggatgctcgtaaaagccgc
cgccatattcgcgcgctgcgccgggattttgtcgatcagctaagccgccatccaacactg
agtgaaagcgaatttgaatcgctcacttatcatcacgtcagtcagttgagtaacagccag
gatgcgctggctcgccgttggttattacgctggggtgtagtgctgctgaactgttctcat
gttgtctggcaattgcgcgactgggaatcgcgttccgatccgttatcgcgagtacgggat
aactgtatttcactgttgcggggagtgatgagtgagcgtggcgttcagcaaaaatcactg
gcggccacacttgaagaattacagcggatttgcgacagccttgcccgtcatcatcaacct
gccgcccgtgagctggcggcaattgtctggcggctgtactgctcgctttcgcaacttgag
caagcaccaccgcaaggtacgctggcctcttaa
              
                            

Download fasta file
RegulonDB